99
|
Dojindo Labs
e 8300 cell E 8300 Cell, supplied by Dojindo Labs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/e 8300 cell/product/Dojindo Labs Average 99 stars, based on 1 article reviews
e 8300 cell - by Bioz Stars,
2026-04
99/100 stars
|
Buy from Supplier |
96
|
Zymo Research
d4010 deposited data medip seq D4010 Deposited Data Medip Seq, supplied by Zymo Research, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/d4010 deposited data medip seq/product/Zymo Research Average 96 stars, based on 1 article reviews
d4010 deposited data medip seq - by Bioz Stars,
2026-04
96/100 stars
|
Buy from Supplier |
99
|
STATA Corporation
sdhs 2020 data Sdhs 2020 Data, supplied by STATA Corporation, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/sdhs 2020 data/product/STATA Corporation Average 99 stars, based on 1 article reviews
sdhs 2020 data - by Bioz Stars,
2026-04
99/100 stars
|
Buy from Supplier |
90
|
Ambry Genetics
clinical testing for sdhx  Clinical Testing For Sdhx, supplied by Ambry Genetics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/clinical testing for sdhx/product/Ambry Genetics Average 90 stars, based on 1 article reviews
clinical testing for sdhx - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Bioscientifica Ltd
chromaffin cell model Chromaffin Cell Model, supplied by Bioscientifica Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/chromaffin cell model/product/Bioscientifica Ltd Average 90 stars, based on 1 article reviews
chromaffin cell model - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Cyagen Biosciences
sdhb atggcaaatttcttgatacg fisher scientific n a recombinant dna plv Sdhb Atggcaaatttcttgatacg Fisher Scientific N A Recombinant Dna Plv, supplied by Cyagen Biosciences, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/sdhb atggcaaatttcttgatacg fisher scientific n a recombinant dna plv/product/Cyagen Biosciences Average 90 stars, based on 1 article reviews
sdhb atggcaaatttcttgatacg fisher scientific n a recombinant dna plv - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
93
|
Addgene inc
sdhb atggcaaatttcttgatacg fisher scientific n a recombinant dna plv Sdhb Atggcaaatttcttgatacg Fisher Scientific N A Recombinant Dna Plv, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/sdhb atggcaaatttcttgatacg fisher scientific n a recombinant dna plv/product/Addgene inc Average 93 stars, based on 1 article reviews
sdhb atggcaaatttcttgatacg fisher scientific n a recombinant dna plv - by Bioz Stars,
2026-04
93/100 stars
|
Buy from Supplier |
90
|
Cyagen Biosciences
piggybac pnmt tta cyagen biosciences n a mouse Piggybac Pnmt Tta Cyagen Biosciences N A Mouse, supplied by Cyagen Biosciences, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/piggybac pnmt tta cyagen biosciences n a mouse/product/Cyagen Biosciences Average 90 stars, based on 1 article reviews
piggybac pnmt tta cyagen biosciences n a mouse - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
96
|
Taconic Biosciences
c b igh 1b icrtac prkdcscid taconic biosciences tac cb17sc oligonucleotides primer C B Igh 1b Icrtac Prkdcscid Taconic Biosciences Tac Cb17sc Oligonucleotides Primer, supplied by Taconic Biosciences, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/c b igh 1b icrtac prkdcscid taconic biosciences tac cb17sc oligonucleotides primer/product/Taconic Biosciences Average 96 stars, based on 1 article reviews
c b igh 1b icrtac prkdcscid taconic biosciences tac cb17sc oligonucleotides primer - by Bioz Stars,
2026-04
96/100 stars
|
Buy from Supplier |
90
|
DIAGENODE DIAGNOSTICS
ideal chip-qpcr kit Ideal Chip Qpcr Kit, supplied by DIAGENODE DIAGNOSTICS, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/ideal chip-qpcr kit/product/DIAGENODE DIAGNOSTICS Average 90 stars, based on 1 article reviews
ideal chip-qpcr kit - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Janvier Labs
nmri nude mice Nmri Nude Mice, supplied by Janvier Labs, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/nmri nude mice/product/Janvier Labs Average 90 stars, based on 1 article reviews
nmri nude mice - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Genetics in Medicine
Article Title: Quantifying evidence toward pathogenicity for rare phenotypes: The case of succinate dehydrogenase genes, SDHB and SDHD
doi: 10.1016/j.gim.2021.08.004
Figure Lengend Snippet: Case-only subphenotype analyses
Article Snippet: The Ambry data set comprised per-variant summary results from clinical testing for
Techniques: Isolation